Home | Molecular Biology | Molecular Biology Applications | In vitro Transcription | In vitro Transcription Enzymes

SP6 RNA Polymerase

High concentration available Recombinant enzyme Thermal inactivation at 70°C in 10 min

SP6 RNA polymerase is DNA-dependent RNA polymerase catalyzes the 5'→3' synthesis of RNA on either single-stranded or double-stranded DNA under control of the SP6 promoter
  
Loading...
Thermo Scientific Bacteriophage SP6 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from its promoter and incorporates modified nucleotides.

Highlights

  • Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

  • Synthesis of unlabeled and labeled RNA that can be used:
    • For hybridization (see Reference 1), in vitro RNA translation (see​ Reference 2)
    • As aRNA (see​ Reference 3), siRNA (see​ Reference 4), substrate in RNase protection assays (see​ Reference 5), template for genomic DNA sequencing (see​ Reference 6)
    • In studies of RNA secondary structure and RNA-protein interactions (see​ Reference 7), RNA splicing (see​ Reference 8)
     

Note

Consensus promoter sequences:

T3AATTAACCCTCACTAAAGGGAGA 
T7TAATACGACTCACTATAGGGAGA 
SP6ATTTAGGTGACACTATAGAAGNG 

The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively (see​ Reference 9).

  
Storage Condition-20 C
HazardousNo
5× Transcription Buffer200 mM Tris-HCl (pH 7.9 at 25°C), 30 mM MgCl2, 50 mM DTT, 50 mM NaCl, 10 mM spermidine.
Definition of Activity UnitOne unit of the enzyme incorporates 1 nmol of AMP into a polynucleotide fraction (adsorbed on DE-81) in 60 minutes at 37°C. Enzyme activity is assayed in the following mixture: 40 mM Tris-HCl (pH 8.0), 6 mM MgCl2, 10 mM DTT, 2 mM spermidine, 0.5 mM of each NTP, 0.6 MBq/mL [3H]-ATP, 20 µg/mL plasmid DNA containing the appropriate promoter sequences.
InactivationInactivated by heating at 70°C for 10 min or by addition of EDTA.
InhibitionInhibitors: metal chelators, enzyme activity is reduced by 50% at NaCl or KCl concentration above 150 mM. Greater than 50% reduction in enzyme activity with ammonium sulphate.
Molecular Weight99 kDa monomer
Quality Control
  • The absence of endo-, exodeoxyribonucleases, and ribonucleases confirmed by appropriate tests.
  • Functionally tested in in vitro transcription reaction.
SourceE. coli cells with a cloned gene encoding SP6 RNA polymerase.
Storage BufferPolymerase is supplied in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM DTT, 0.1 mg/mL BSA, 0.03% (v/v) ELUGENT Detergent, 50% (v/v) glycerol.

References

  1. D. A. Melton et al., Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 12, 7035-7056 (1984).
  2. P. A. Krieg, D.A. Melton, Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. Nucleic Acids Res. 12, 7057-7070 (1984).
  3. D. A. Melton, Injected antisense RNAs specifically block messenger RNA translation in vivo. Proc. Natl. Acad. Sci. USA. 82, 144-148 (1985).
  4. E. Bernstein et al., Role for bidentate ribonuclease in the initiation step of RNA interference. Nature. 409, 363-366 (2001).
  5. C. L. Peebles et al., A self-splicing RNA excises an intron lariat. Cell. 44, 213-223 (1986).
  6. G .M. Church, W. Gilbert, Genomic sequencing. Proc. Natl. Acad. Sci. USA. 81, 1991-1995 (1984).
  7. G. W. Witherell et al., Cooperative binding of R17 coat protein to RNA. Biochemistry. 29, 11051-11057 (1990).
  8. A. R. Krainer et al., Normal and mutant human beta-globin pre-mRNAs are faithfully and efficiently spliced in vitro. Cell. 36, 993-1005 (1984).
  9. E. D. Jorgensen et al., Specific contacts between the bacteriophage T3, T7, and SP6 RNA polymerases and their promoters. J. Biol. Chem. 266, 645-651 (1991).