CloneJET PCR Cloning Kit

Available On-Site


CloneJET PCR Cloning Kit contents
CloneJET PCR Cloning Kit is a positive selection system for efficient cloning of PCR products generated with any thermostable DNA polymerase.
  
Loading...

The Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high-efficiency cloning of PCR products generated with any thermostable DNA polymerase. Any other blunt or sticky-end DNA fragment can be cloned. It is ideal for phosphorylated or non-phosphorylated DNA fragments. Ligation into the included positive selection vector takes only 5 minutes, yielding more than 99% recombinant clones. Blunt-ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector.

PCR products generated either with non-proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit. All common laboratory E. coli strains can be directly transformed with the ligation product.

Features

The CloneJET PCR Cloning Kit contains a novel, ready-to-use positive selection cloning vector pJET1.2pJET1.2 sequence/blunt. The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site. As a result, only bacterial cells with recombinant plasmids are able to form colonies. Recircularized pJET1.2pJET1.2 sequence/blunt vector molecules lacking an insert express a lethal restriction enzyme, which kills the host E. coli cell after transformation. This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue/white selection.

For convenience in mapping and manipulation of the insert, the pJET1.2pJET1.2 sequence/blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site. In addition, the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert.

Highlights

  • Fast – PCR cloning in only 5 minutes
  • Highest efficiency – > 99% of positive clones
  • No cloning background – positive selection vector
  • Versatile – ideal for blunt-end or sticky-end cloning
  • Economical – no expensive blue/white screening

Applications

  • Cloning of blunt-end or 3'-dA tailed PCR products up to 10 kb
  • Cloning of DNA fragments generated by restriction enzymes
  • Sequencing of cloned DNA
  • in vitro and in vivo transcription of cloned inserts from the T7 promoter

Includes

Download sequences

>pJET1.2
gcccctgcagccgaattatattatttttgccaaataatttttaacaaaagctctgaagtcttcttcatttaaattcttag atgatacttcatctggaaaattgtcccaattagtagcatcacgctgtgagtaagttctaaaccatttttttattgttgta ttatctctaatcttactactcgatgagttttcggtattatctctatttttaacttggagcaggttccattcattgttttt ttcatcatagtgaataaaatcaactgctttaacacttgtgcctgaacaccatatccatccggcgtaatacgactcactat agggagagcggccgccagatcttccggatggctcgagtttttcagcaagatatctttctagaagatctcctacaatattc tcagctgccatggaaaatcgatgttcttcttttattctctcaagattttcaggctgtatattaaaacttatattaagaac tatgctaaccacctcatcaggaaccgttgtaggtggcgtgggttttcttggcaatcgactctcatgaaaactacgagcta aatattcaatatgttcctcttgaccaactttattctgcattttttttgaacgaggtttagagcaagcttcaggaaactga gacaggaattttattaaaaatttaaattttgaagaaagttcagggttaatagcatccattttttgctttgcaagttcctc agcattcttaacaaaagacgtctcttttgacatgtttaaagtttaaacctcctgtgtgaaattattatccgctcataatt ccacacattatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgtt gcgctcactgccaattgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagag gcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggta tcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggcca gcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaa atcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtg cgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatag ctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccg accgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccact ggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactag aaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaac aaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcct ttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaag gatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgaca gttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtc gtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggc tccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatcc agtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctaca ggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatc ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcac tcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactca accaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccaca tagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagat ccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaa acaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaata ttattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatagggg ttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaatagg cgtatcacgaggcc
>Control PCR Product Sequence (976bp) (from #K1231, #K1232 CloneJET PCR Cloning Kit
ACTGCTGGACCACCTGAAACGTGGCACTCTGGACCTCTCTAAACTGAGCGGTCTGGTTCTGGATGAAGCTGACGAAATGC TGCGCATGGGCTTCATCGAAGACGTTGAAACCATTATGGCGCAGATCCCGGAAGGTCATCAGACCGCTCTGTTCTCTGCA ACCATGCCGGAAGCGATTCGTCGCATTACCCGCCGCTTTATGAAAGAGCCGCAGGAAGTGCGCATTCAGTCCAGCGTGAC TACCCGTCCTGACATCAGCCAGAGCTACTGGACTGTCTGGGGTATGCGCAAAAACGAAGCACTGGTACGTTTCCTGGAAG CGGAAGATTTTGATGCGGCGATTATCTTCGTTCGTACCAAAAACGCGACTCTGGAAGTGGCTGAAGCTCTTGAGCGTAAC GGCTACAACAGCGCCGCGCTGAACGGTGACATGAACCAGGCGCTGCGTGAACAGACACTGGAACGCCTGAAAGATGGTCG TCTGGACATCCTGATTGCGACCGACGTTGCAGCCCGTGGCCTGGACGTTGAGCGTATCAGCCTGGTAGTTAACTACGATA TCCCGATGGATTCTGAGTCTTACGTTCACCGTATCGGTCGTACCGGTCGTGCGGGTCGTGCTGGCCGCGCGCTGCTGTTC GTTGAGAACCGCGAGCGTCGTCTGCTGCGCAACATTGAACGTACTATGAAGCTGACTATTCCGGAAGTAGAACTGCCGAA CGCAGAACTGCTAGGCAAACGCCGTCTGGAAAAATTCGCCGCTAAAGTACAGCAGCAGCTGGAAAGCAGCGATCTGGATC AATACCGCGCACTGCTGAGCAAAATTCAGCCGACTGCTGAAGGTGAAGAGCTGGATCTCGAAACTCTGGCTGCGGCACTG CTGAAAATGGCACAGGGTGAACGTACTCTGATCGTACCGCCAGATGCGCCGATGCGTCCGAAACGTGAATTCCGGATGAG CATTCATCAGGCGGGT

Note

Prior to electroporation, always column-purify the ligation mixture using e.g. GeneJET PCR Purification Kit #K0701 or chloroform to extract it. Electroporation is inhibited by the presence of proteins and salts in the mixture.

  
HazardousNo
Quality ControlThe kit is functionally tested by cloning a control 3'-dA tailed PCR product. Typical yield of recombinant clones is >99%. The cloning vector is tested in a self-ligation experiment for the absence of cloning background. The pJET1.2 primers are tested for specific and efficient sequencing.
Storage Condition-20 C
CloneJET Cloning Procedure

CloneJET Cloning Procedure

CloneJET Cloning Procedure

Table 1. CloneJET Cloning Procedure


pJET1.2/blunt vector map

pJET1.2/blunt vector map


Efficiency of different blunt-end PCR cloning systems with positive selection

Efficiency of different blunt-end PCR cloning systems with positive selection

Efficiency of different blunt-end PCR cloning systems with positive selection

Figure 2. Cloning of blunt-end PCR product: efficiency of different blunt-end PCR cloning systems with positive selection.
A 976 bp blunt-end PCR product, generated with Pfu DNA Polymerase, was directly ligated into different positive selection blunt-end PCR cloning vectors according to suppliers protocols. Ligation mixtures (2 µL) were used to transform E. coli DH10B cells. Transformation efficiency of competent cells was 1 x 107 transformants per µg supercoiled DNA.


Efficiency of different PCR cloning strategies for 3'-dA tailed PCR product

Efficiency of different PCR cloning strategies for 3'-dA tailed PCR product

Efficiency of different PCR cloning strategies for 3'-dA tailed PCR product

Figure 3. Cloning of 3’-dA tailed PCR product: efficiency of different PCR cloning strategies.
A 976 bp 3’-dA tailed PCR product, generated with Taq DNA Polymerase, was ligated into pJET1.2/blunt and into different TA cloning vectors according to suppliers protocols. Ligation mixtures (2 µL) were used to transform E. coli DH10B cells. Transformation efficiency of competent cells was 1 x 107 transformants per µg supercoiled DNA.


References

  1. B. K. Michelsen, Transformation of Escherichia coli increases 260-fold upon inactivation of T4 DNA ligase. Anal. Biochem. 225, 172-174 (1995).

Citations