CloneJET PCR Cloning Kit

Available On-Site


CloneJET PCR Cloning Kit contents
CloneJET PCR Cloning Kit is a positive selection system for efficient cloning of PCR products generated with any thermostable DNA polymerase.
  
Loading...

Features

The CloneJET PCR Cloning Kit contains a novel, ready-to-use positive selection cloning vector pJET1.2pJET1.2 sequence/blunt. The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site. As a result, only bacterial cells with recombinant plasmids are able to form colonies. Recircularized pJET1.2pJET1.2 sequence/blunt vector molecules lacking an insert express a lethal restriction enzyme, which kills the host E. coli cell after transformation. This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue/white selection.

For convenience in mapping and manipulation of the insert, the pJET1.2pJET1.2 sequence/blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site. In addition, the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert.

Highlights

  • Fast – PCR cloning in only 5 minutes
  • Highest efficiency – > 99% of positive clones
  • No cloning background – positive selection vector
  • Versatile – ideal for blunt-end or sticky-end cloning
  • Economical – no expensive blue/white screening

Applications

  • Cloning of blunt-end or 3'-dA tailed PCR products up to 10 kb
  • Cloning of DNA fragments generated by restriction enzymes
  • Sequencing of cloned DNA
  • in vitro and in vivo transcription of cloned inserts from the T7 promoter

Includes

Download sequences

>pJET1.2
gcccctgcagccgaattatattatttttgccaaataatttttaacaaaagctctgaagtcttcttcatttaaattcttag atgatacttcatctggaaaattgtcccaattagtagcatcacgctgtgagtaagttctaaaccatttttttattgttgta ttatctctaatcttactactcgatgagttttcggtattatctctatttttaacttggagcaggttccattcattgttttt ttcatcatagtgaataaaatcaactgctttaacacttgtgcctgaacaccatatccatccggcgtaatacgactcactat agggagagcggccgccagatcttccggatggctcgagtttttcagcaagatatctttctagaagatctcctacaatattc tcagctgccatggaaaatcgatgttcttcttttattctctcaagattttcaggctgtatattaaaacttatattaagaac tatgctaaccacctcatcaggaaccgttgtaggtggcgtgggttttcttggcaatcgactctcatgaaaactacgagcta aatattcaatatgttcctcttgaccaactttattctgcattttttttgaacgaggtttagagcaagcttcaggaaactga gacaggaattttattaaaaatttaaattttgaagaaagttcagggttaatagcatccattttttgctttgcaagttcctc agcattcttaacaaaagacgtctcttttgacatgtttaaagtttaaacctcctgtgtgaaattattatccgctcataatt ccacacattatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgtt gcgctcactgccaattgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagag gcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggta tcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggcca gcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaa atcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtg cgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatag ctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccg accgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccact ggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactag aaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaac aaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcct ttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaag gatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgaca gttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtc gtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggc tccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatcc agtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctaca ggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatc ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcac tcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactca accaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccaca tagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagat ccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaa acaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaata ttattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatagggg ttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaatagg cgtatcacgaggcc
>Control PCR Product Sequence (976bp) (from #K1231, #K1232 CloneJET PCR Cloning Kit
ACTGCTGGACCACCTGAAACGTGGCACTCTGGACCTCTCTAAACTGAGCGGTCTGGTTCTGGATGAAGCTGACGAAATGC TGCGCATGGGCTTCATCGAAGACGTTGAAACCATTATGGCGCAGATCCCGGAAGGTCATCAGACCGCTCTGTTCTCTGCA ACCATGCCGGAAGCGATTCGTCGCATTACCCGCCGCTTTATGAAAGAGCCGCAGGAAGTGCGCATTCAGTCCAGCGTGAC TACCCGTCCTGACATCAGCCAGAGCTACTGGACTGTCTGGGGTATGCGCAAAAACGAAGCACTGGTACGTTTCCTGGAAG CGGAAGATTTTGATGCGGCGATTATCTTCGTTCGTACCAAAAACGCGACTCTGGAAGTGGCTGAAGCTCTTGAGCGTAAC GGCTACAACAGCGCCGCGCTGAACGGTGACATGAACCAGGCGCTGCGTGAACAGACACTGGAACGCCTGAAAGATGGTCG TCTGGACATCCTGATTGCGACCGACGTTGCAGCCCGTGGCCTGGACGTTGAGCGTATCAGCCTGGTAGTTAACTACGATA TCCCGATGGATTCTGAGTCTTACGTTCACCGTATCGGTCGTACCGGTCGTGCGGGTCGTGCTGGCCGCGCGCTGCTGTTC GTTGAGAACCGCGAGCGTCGTCTGCTGCGCAACATTGAACGTACTATGAAGCTGACTATTCCGGAAGTAGAACTGCCGAA CGCAGAACTGCTAGGCAAACGCCGTCTGGAAAAATTCGCCGCTAAAGTACAGCAGCAGCTGGAAAGCAGCGATCTGGATC AATACCGCGCACTGCTGAGCAAAATTCAGCCGACTGCTGAAGGTGAAGAGCTGGATCTCGAAACTCTGGCTGCGGCACTG CTGAAAATGGCACAGGGTGAACGTACTCTGATCGTACCGCCAGATGCGCCGATGCGTCCGAAACGTGAATTCCGGATGAG CATTCATCAGGCGGGT

Note

Prior to electroporation, always column-purify the ligation mixture using e.g. GeneJET PCR Purification Kit #K0701 or chloroform to extract it. Electroporation is inhibited by the presence of proteins and salts in the mixture.

  
HazardousNo
Quality ControlThe kit is functionally tested by cloning a control 3'-dA tailed PCR product. Typical yield of recombinant clones is >99%. The cloning vector is tested in a self-ligation experiment for the absence of cloning background. The pJET1.2 primers are tested for specific and efficient sequencing.
Storage Condition-20 C
CloneJET Cloning Procedure

CloneJET Cloning Procedure

CloneJET Cloning Procedure

Table 1. CloneJET Cloning Procedure


pJET1.2/blunt vector map

pJET1.2/blunt vector map


Efficiency of different blunt-end PCR cloning systems with positive selection

Efficiency of different blunt-end PCR cloning systems with positive selection

Efficiency of different blunt-end PCR cloning systems with positive selection

Figure 2. Cloning of blunt-end PCR product: efficiency of different blunt-end PCR cloning systems with positive selection.
A 976 bp blunt-end PCR product, generated with Pfu DNA Polymerase, was directly ligated into different positive selection blunt-end PCR cloning vectors according to suppliers protocols. Ligation mixtures (2 µL) were used to transform E. coli DH10B cells. Transformation efficiency of competent cells was 1 x 107 transformants per µg supercoiled DNA.


Efficiency of different PCR cloning strategies for 3'-dA tailed PCR product

Efficiency of different PCR cloning strategies for 3'-dA tailed PCR product

Efficiency of different PCR cloning strategies for 3'-dA tailed PCR product

Figure 3. Cloning of 3’-dA tailed PCR product: efficiency of different PCR cloning strategies.
A 976 bp 3’-dA tailed PCR product, generated with Taq DNA Polymerase, was ligated into pJET1.2/blunt and into different TA cloning vectors according to suppliers protocols. Ligation mixtures (2 µL) were used to transform E. coli DH10B cells. Transformation efficiency of competent cells was 1 x 107 transformants per µg supercoiled DNA.


References

  1. B. K. Michelsen, Transformation of Escherichia coli increases 260-fold upon inactivation of T4 DNA ligase. Anal. Biochem. 225, 172-174 (1995).

Citations