InsTAclone PCR Cloning Kit


TA Cloning kit designed for cloning directly from a PCR reaction. It takes only one hour from the completion of PCR to cell plating.
  
Loading...

Thermo Scientific InsTAclone PCR Cloning Kit is a TA system for direct one-step cloning of PCR products with 3'-dA overhangs (see Reference 1) generated by Taq DNA polymerase and other thermostable DNA polymerases, which lack proofreading activity. The high quality ready-to-use TA cloning vector pTZ57R/T (see Figure 1 in Supporting Data) was prepared by linearizing the pTZ57R plasmid with Eco32I and tailing with single ddT. The 3'-ddT overhangs at both ends of the cloning site prevent recircularization of the vector during ligation, resulting in high cloning yields and low background.

To increase the speed, convenience, and efficiency of cloning experiment, the kit has been combined with the unique TransformAid Bacterial Transformation Kit – a set of solutions for preparation of chemically competent E. coli cells. 

Highlights

  • Fast cloning – approximately one hour from PCR completion to cell plating
  • High efficiency – more than 90% of the recombinant clones contain the target DNA
  • One-step procedure – additional modifications of PCR fragment are not required
  • Compatibility – compatible with Taq, Tth, Tfl, and other non-proofreading DNA polymerases as well as with Long PCR Enzyme Mix
  • Convenience of pTZ57R/T cloning vector:
    • Ready-to-use: linearized with Eco32I and 3’-ddT tailed
    • MCS designed for easy mapping and manipulation of the cloned insert
    • Blue/white screening
    • M13/pUC primer sites for sequencing or colony PCR screening
    • T7 promoter for in vitro transcription of the insert

According to the protocol, ligation and preparation of competent cells is performed in parallel. Therefore, it takes only one hour from the completion of PCR to cell plating. Our transformation protocol is often faster than the transformation of commercially available competent cells. The DNA insert can be readily excised from the versatile polylinker of pTZ57R/T, sequenced using standard M13/pUC primers or in vitro transcribed with T7 RNA polymerase.

Applications

  • TA cloning
  • Sequencing of cloned insert
  • in vitro transcription of insert DNA

Includes

>Sequence (953bp) of Control PCR Product (from #K1213, #K1214 InsTAclone™ PCR Cloning Kit)
aatggatccttaaaaatctcccgaagcgacttgccagcattcaacaccgatacgacgccacatttcaact
acttgagttcggtcatcaatagctaatttcacgtcaaaatgcggtgcaatgtgtttccagaaaatttctt
ctttaactacatcgtctttacgggtatcgccttgttcgcgctgacattgcataactaatggaacgccagc
aatgtcctcaacccatttacgggtcatacgataatatttcgttgggtcttctttagttccactttcacga
cctgaaacgactacgatttgataacccataagagcatacatcttagacagttcaacaaccataggattga
taacatcggtatcgcatttttcaaggtcataaggaccacgaccattcattttagctagtgtaccatcaac
atcaaaaataactgcttttggtttaccaggagtcccattatatactggaagaccgagatactctcgcatg
cttttatacattgaacgtaaaacatcaattggtactgctttagttccgcgttttgagttacgtttaacca
attcagtccaaggaacatcaaacactttatgttcaactttccagccgtattctttggcaaaagtttccca
tgctaggcgacgttcaggattcaggttagtatctgaaatgattactcccttaacagaatcgccaccgtac
agaatacttttagctgtatcaaactgcataccagttacgataccttctttctttttggtatacttgtact
catcgcgttcttcatgcgccataatagattggcgatagtcatcacgattgatattataaaacccgggatt
cttagcaataaattcacgagcccaagtactcttaccagaaccaggacagccaatagtcaaaataatcttt
ttcatttattttttctcaactaatgattgaatatccggatgtt
> pTZ57R Plasmid sequence (2886 bp) gacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccct agcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggc tccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtggg ccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactgg aacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatg agctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttccattcgccattcaggctgcgca actgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgatta agttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacctcgcgaat gcatctagatatcggatcccgggcccgtcgactgcagaggcctgcatgcaagctttccctatagtgagtcgtattagagc ttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaag cataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagt cgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttcc gcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacg gttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaagg ccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcga aacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgct taccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcgg tgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactat cgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggta tgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctc tgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttt tttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgc tcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatt aaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggca cctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggaggg cttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagc cagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagct agagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtt tggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggtta gctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataat tctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtat gcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatca ttggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgca cccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaa gggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttatt gtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtg
ccacct

Note

E. coli strains are not included. Suitable for all common laboratory E. coli strains.

  
HazardousNo
Quality Control
  • The kit is functionally tested by the cloning efficiency of a control PCR product.
  • Typical yield of the recombinant clones is higher than 90%.
  • The transformation system - TransformAid Bacterial Transformation Kit is tested in transformation of E.coli strains XL1-Blue and JM107 with pUC19 DNA.
  • Typical transformation efficiency is more than 107 transformants per µg of supercoiled pUC19 DNA.
Storage Condition-20 C
Restriction map of vector pTZ57R/T

Restriction map of vector pTZ57R/T

Restriction map of vector pTZ57R/T

Restriction map of vector pTZ57R/T.


PCR product cloning procedure

PCR product cloning procedure

PCR product cloning procedure

PCR product cloning procedure


References

  1. J. M. Clark, Novel non-templated nucleotide addition reactions catalyzed by prokaryotic and eukaryotic DNA polymerases. Nucl. Acids Res16(20), 9677-9686 (1988).

Citations