Previously added items:
Thermo Scientific First Strand cDNA Synthesis kit utilizes the recombinant M-MuLV Reverse Transcriptase which exhibits lower RNase H activity than AMV reverse transcriptase. Due to this feature, full-length cDNA can be synthesized from RNA templates up to 9 kb. The recombinant RiboLock RNase Inhibitor, supplied with the kit effectively protects RNA template from degradation.
The first strand of cDNA can be directly used as a template in PCR or in second strand cDNA synthesis.
CAAGGTCATCCATGACAACTTTG
GTCCACCACCCTGTTGCTGTAG
The kit is supplied with both oligo(dT)18 and random hexamer primers. The oligo(dT)18 anneals selectively on the poly(A) tail of mRNA. Random hexamer primers do not require the presence of poly(A). Therefore, they can be used for transcription of the 5'-end regions of mRNA or cDNA synthesis using RNA without poly(A) tail e.g. micro RNAs. Gene-specific primers may also be used with the kits.
Total RNA isolated from the patient blood infected with hepatitis C virus was used as a template in a reverse transcription reaction using First Strand cDNA Synthesis Kit. An oligonucleotide specific to the 3’-end of the viral RNA was used as a primer. The synthesized 9.4 kb cDNA was used as a template in subsequent PCR reactions with Taq DNA Polymerase. The ability to amplify the terminal 212 bp sequence indicates that the entire 9.4 kb viral RNA sequence was reverse-transcribed.